Prev. |  KEGG KO K18733 > 

RIKEN DNA Bank Human Resource - LARP6

Gene ID NCBI Gene 55323 |  KEGG hsa:55323
Gene Symbol LARP6
Protein Name La ribonucleoprotein 6, translational regulator
Synonyms ACHN
Ortholog resource in our bank

  LARP6

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087245 IRAL018B21 pOTB7 BC006082 NM_018357 Full
HGY089391 IRAL023H23 pOTB7 BC009446 NM_018357 Full
HGY091429 IRAL028J13 pOTB7 BC014018 NM_018357 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE007225 W01A018B01 pENTR-TOPO IRAL028J13 BC014018 NM_018357  
HGE007229 W01A018B05 pENTR-TOPO IRAL028J13 BC014018 NM_018357  
HGE007233 W01A018B09 pENTR-TOPO IRAL018B21 BC006082 NM_018357  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR041377 ARe03H09 pKA1U5 NM_018357.2  
GAGTCGCTGCCGACCGGCTGGCTGGGCCTTGCGGCGTTGAGGACCCCGGCGGCGCCGCAG
HKR181370 ARi53H02 pGCAP10 NM_018357.2  
GACCGGCTGGCTGGGCCTTGCGGCGTGAGGACCCCGGCGGCGCCGCAGTCCCGCGAGCCA
HKR219676 ARiS049D04 pGCAP10 NM_018357.2  
GAGTCGCTGCCGACCGGCTGGCTGGGCCTTGCGGCGTGAGGACCCCGGCGGCGCCGCAGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl