Prev. |  KEGG KO K15014 > 

RIKEN DNA Bank Human Resource - SLC29A3

Gene ID NCBI Gene 55315 |  KEGG hsa:55315
Gene Symbol SLC29A3
Protein Name solute carrier family 29 member 3
Synonyms ENT3|HCLAP|HJCD|PHID
Ortholog resource in our bank

  SLC29A3

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082553 IRAL006G09 pOTB7 BC000223 NM_018344 Partial
HGY097698 IRAL044E02 pOTB7 BC041575 NM_018344 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2022Apr03.csv
GNP_full_IRAL_2022Apr03.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR320877 RBb02D05 pKA1U5 NM_018344.4  
GAAGCCCAGTGGTCCTGGCCGTGCGCCGGAGGCAGCGGCGGCGTGGCGCAGCGGCGACAT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2022Apr03.csv
NRCDhumcloneList_RB_2022Apr03.csv

2022.09.29

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl