Prev. |  KEGG KO K18655 > 

RIKEN DNA Bank Human Resource - DDX19A

Gene ID NCBI Gene 55308 |  KEGG hsa:55308
Gene Symbol DDX19A
Protein Name DEAD-box helicase 19A
Synonyms DDX19-DDX19L|DDX19L
Ortholog resource in our bank

  DDX19A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY080848 IRAL002B24 pOTB7 BC006544 NM_018332
HGY084707 IRAL011M19 pOTB7 BC005162 NM_018332 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070012 ARe75A12 pKA1U5 NM_018332.3  
GCTCGCGCCGGTGGCGAGGTTAGGGCCCGCGCTTGCNACGTGGTGCAGCGCATATTTTCA
HKR393329 RBd83F09 pGCAP10 NM_018332.3  
GCGCGTTGCGACGTGGTGCAGCGCATATTTTCACAAGTGGGTCTCCCTTGTCCGGGACTA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl