Prev. |  KEGG KO K13111 > 

RIKEN DNA Bank Human Resource - SMU1

Gene ID NCBI Gene 55234 |  KEGG hsa:55234
Gene Symbol SMU1
Protein Name SMU1 DNA replication regulator and spliceosomal factor
Synonyms BWD|SMU-1|fSAP57
Ortholog resource in our bank

  SMU1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY086103 IRAL015E07 pOTB7 BC002876 NM_018225 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247439 ARiS118J23 pGCAP10 NM_018225.2  
GGGTGTGTTGCGCGACTGGCCTTGAGGGAGAGCTGGGGCCTGCTCCCGGAGAGATACGGC
HKR373201 RBd33A01 pGCAP10 NM_018225.2  
GGTGTTGCGCGACTGGCCTTGAGGGAGAGCTGGGGCCTGCTCCCGGAGAGATACGGCTAT
HKR389749 RBd74G05 pGCAP10 NM_018225.2  
GGTTGCGCGACTGGCCTTGAGGGAGAGCTGGGGCCTGCTCCCGGAGAGATACGGCTATGT
HKR402832 RBdS007B08 pGCAP10 NM_018225.2  
GGTTGGTGTGTTGCGCGACTGGCCTTGAGGGAGAGCTGGGGCCTGCTCCCGGAGAGATAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl