Prev. |  KEGG KO K06685 > 

RIKEN DNA Bank Human Resource - MOB1A

Gene ID NCBI Gene 55233 |  KEGG hsa:55233
Gene Symbol MOB1A
Protein Name MOB kinase activator 1A
Synonyms C2orf6|MATS1|MOB1|MOBK1B|MOBKL1B|Mob4B
Featured content Hippo signaling (human)
Ortholog resource in our bank

  MOB1A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001560 IRAK003O24 pCMV-SPORT6 BC003398 NM_018221 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR328425 RBb21B01 pKA1U5 NM_018221.3  
GGTGGGGTAGGCGGGCAAGGCGGGCGCCGAGGTTTGCAAGGGCTCGCAGCGGCCAGAAAC
HKR405703 RBdS014E07 pGCAP10 NM_018221.3  
GGGGCGCCGAGGTTTGCAAGGGCTCGCAGCGGCCAGAAACCCGGCTCCGAGCGGCGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl