Prev. |  KEGG KO K11869 > 

RIKEN DNA Bank Human Resource - USP40

Gene ID NCBI Gene 55230 |  KEGG hsa:55230
Gene Symbol USP40
Protein Name ubiquitin specific peptidase 40
Synonyms -
Ortholog resources KEGG ortholog (KEGG orthology K11869) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR168548 ARi21G04 pGCAP10 NM_018218.2  
GGTACTGTTAGAGCGGGCTCTGCCCTGGTGAATTCTACTCCCATGGAAGTTAATTCCAAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl