Prev. | Human A to Z list > C > 

RIKEN DNA Bank Human Resource - C11orf57

Gene ID (NCBI) 55216
Gene Symbol C11orf57
Protein Name chromosome 11 open reading frame 57
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX001696 IRAK004D24 pCMV-SPORT6 BC005403 NM_018195 Full/var
HGX025702 IRAK064E06 pCMV-SPORT6 BC030546 NM_018195 Full/var
HGX069904 IRAK174M16 pCMV-SPORT6 BC072455 NM_018195 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR172903 ARi32E07 pGCAP10 NM_018195.3  
TGCTTCCCCCCTACCCCCCGCCACGCGAGGCTGCGGCGCACGATTGAAGAATGTCCCGGA
HKR382483 RBd56D11 pGCAP10 NM_018195.3  
GGAGGCTGCGGCGCACGGTATGGGTGTGTTTGTGTGTATTTGTGTGGGGAGGGCGTTTGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl