Prev. |  KEGG KO K10895 > 

RIKEN DNA Bank Human Resource - FANCI

Gene ID NCBI Gene 55215 |  KEGG hsa:55215
Gene Symbol FANCI
Protein Name FA complementation group I
Synonyms KIAA1794
Ortholog resource in our bank

  FANCI

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX017027 IRAK042J11 pCMV-SPORT6 BC021859 NM_018193 Partial/var
HGY085421 IRAL013J05 pOTB7 BC004277 NM_018193 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2021Apr07.csv
GNP_full_IRAL_2021Apr13.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE124837 M01C112B13 pDONR221 06-2_04-G07 AK001581 NM_018193  
HGE124885 M01C112D13 pDONR221 06-2_04-G07 AK001581 NM_018193  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_210404.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR392901 RBd82E05 pGCAP10 NM_018193.2  
TAGCGGGCTTTTTGGAAGTTTGTGGCGGAGGTGAGGCCGAGGTGACTGCAGAGCGGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2022.03.15

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_220215.pl