Prev. |  KEGG KO K17681 > 

RIKEN DNA Bank Human Resource - ATAD3A

Gene ID NCBI Gene 55210 |  KEGG hsa:55210
Gene Symbol ATAD3A
Protein Name ATPase family AAA domain containing 3A
Synonyms HAYOS
Ortholog resource in our bank

  ATAD3A

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX053942 IRAK134O06 pCMV-SPORT6 BC063607 NM_018188 Full/var
HGY088203 IRAL020I11 pOTB7 BC007803 NM_018188 Full/var
HGY091219 IRAL028A19 pOTB7 BC011814 NM_018188 Full/var
HGY092009 IRAL030A09 pOTB7 BC014101 NM_018188 Full/var
HGY097374 IRAL043H06 pOTB7 BC033109 NM_018188 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR238481 ARiS096D09 pGCAP10 NM_018188.2  
GAGTGgCgGTGACCACCggctCgCGGCGCGgGGAgGCTGCTCCCAGCCgCGCGCGAGTCA
HKR372528 RBd31F08 pGCAP10 NM_018188.2  
TGCTGGCCACCGGCTCGCGGCGCGTGGAGGCTGCTCCCAGCCGCGCCCGAGTCAGACTCG
HKR390503 RBd76E07 pGCAP10 NM_018188.2  
GGCTCCCAGCCGCGCCCGAGTCAGACTCGGGTGGGGGTCCCGGCGGCGGTAGCGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl