Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - ATAD3A

Gene ID (NCBI) 55210
Gene Symbol ATAD3A
Protein Name ATPase family, AAA domain containing 3A
Synonyms -
Databases KEGG link 01 |  NCBI Gene link 01
Featured content Ortholog resources in the DNA Bank (KEGG orthology K17681)


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX053942 IRAK134O06 pCMV-SPORT6 BC063607 NM_018188 Full/var
HGY088203 IRAL020I11 pOTB7 BC007803 NM_018188 Full/var
HGY091219 IRAL028A19 pOTB7 BC011814 NM_018188 Full/var
HGY092009 IRAL030A09 pOTB7 BC014101 NM_018188 Full/var
HGY097374 IRAL043H06 pOTB7 BC033109 NM_018188 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR238481 ARiS096D09 pGCAP10 NM_018188.2  
GAGTGgCgGTGACCACCggctCgCGGCGCGgGGAgGCTGCTCCCAGCCgCGCGCGAGTCA
HKR372528 RBd31F08 pGCAP10 NM_018188.2  
TGCTGGCCACCGGCTCGCGGCGCGTGGAGGCTGCTCCCAGCCGCGCCCGAGTCAGACTCG
HKR390503 RBd76E07 pGCAP10 NM_018188.2  
GGCTCCCAGCCGCGCCCGAGTCAGACTCGGGTGGGGGTCCCGGCGGCGGTAGCGGCGGCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.29

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl