Prev. |  KEGG KO K07955 > 

RIKEN DNA Bank Human Resource - ARL8B

Gene ID NCBI Gene 55207 |  KEGG hsa:55207
Gene Symbol ARL8B
Protein Name ADP ribosylation factor like GTPase 8B
Synonyms ARL10C|Gie1
Ortholog resources KEGG ortholog (KEGG orthology K07955) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011321 IRAK028F01 pCMV-SPORT6 BC013131 NM_018184 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR072922 ARe82F02 pKA1U5 NM_018184.2  
GCTGGGTCTGGCTGCTGCCGCCCGCCGGNTGTCCGCCCGATGNTCGCGCCGGGGCACCAA
HKR082898 ARf07E02 pKA1U5 NM_018184.2  
GGCCCGTGTCGCGCCGGGGCACCAAGGAGCCGTTGGAGGGTCCGGGCGGAGGCCCGCTCG
HKR341249 RBb53C01 pGCAP1 NM_018184.2  
GCTGGCTGCTGCCGCCCGCCGGTTGTCCGCCCGATGATCGCGCCGGGGCACCAAGGAGCC
HKR370100 RBd25E04 pGCAP10 NM_018184.2  
GGTGGGGGGTAGGGCGAGTCATATGATCCGCTCGGCTTCCTGGGTCTGGCTGCTGCCGCC
HKR384947 RBd62G03 pGCAP10 NM_018184.2  
GATGATATGATCCGCTCGGCTTCCTGGGTCTGGCTGCTGCCGCCCGCCGGTGTCCGCCCG
HKR390406 RBd76A06 pGCAP10 NM_018184.2  
GGCCNNNNNCGCGCCGGGGCACCAAGGAGCCGTTGGAGGGTCCGGGCGGAGGCCCGCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.17

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl