Prev. |  KEGG KO K10429 > 

RIKEN DNA Bank Human Resource - MAP1S

Gene ID NCBI Gene 55201 |  KEGG hsa:55201
Gene Symbol MAP1S
Protein Name microtubule associated protein 1S
Synonyms BPY2IP1|C19orf5|MAP8|VCY2IP-1|VCY2IP1
Ortholog resource in our bank

  MAP1S

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX055959 IRAK139O23 pCMV-SPORT6 BC067115 NM_018174 Full
HGY086219 IRAL015J03 pOTB7 BC008806 NM_018174 Partial
HGY086962 IRAL017G18 pOTB7 BC006358 NM_018174 Partial/var
HGY088914 IRAL022E18 pOTB7 BC007253 NM_018174 Partial/var
HGY103767 IRAL059G23 pOTB7 BC080547 NM_018174 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR405519 RBdS013N07 pGCAP10 NM_018174.4  
GGGGGCGGCCCGAAGATGGCGGCGGTGGCTGGATCTGGGGCTGCCGCGGCTCCGAGCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.09

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl