Prev. |  KEGG KO K20132 > 

RIKEN DNA Bank Human Resource - APPL2

Gene ID NCBI Gene 55198 |  KEGG hsa:55198
Gene Symbol APPL2
Protein Name adaptor protein, phosphotyrosine interacting with PH domain and leucine zipper 2
Synonyms DIP13B
Ortholog resource in our bank

  APPL2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX024959 IRAK062G15 pCMV-SPORT6 BC028008 NM_018171 Full/var
HGX027406 IRAK068I14 pCMV-SPORT6 BC033731 NM_018171 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064054 ARe60C06 pKA1U5 NM_018171.3  
GACTGGCCAGGCGTGGACGCGCGCGGGGCCGCCGCGGGCACGGAGTGGCCGCCGCGTCGC
HKR170907 ARi27E11 pGCAP10 NM_018171.3  
GAGGGCCGGCGGGCAGGCGGCGGCGGCCACTGGCCAGGCGTGGACGCCCGCGGGGNCGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl