Prev. | 

RIKEN DNA Bank Human Resource - RPRD1A

Gene ID NCBI Gene 55197 |  KEGG hsa:55197
Gene Symbol RPRD1A
Protein Name regulation of nuclear pre-mRNA domain containing 1A
Synonyms HsT3101|P15RS
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY082503 IRAL006E07 pOTB7 BC000225 NM_018170 Full/var
HGY091092 IRAL027M04 pOTB7 BC010136 NM_018170 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR008811 ARa22A11 pKA1U5 NM_018170.3  
TTGGGCGGCCGTGGTGAGAGCGTGGGGAAGGGTGGGGTGAGGGGGCGAGGCCGCAGCTAG
HKR386502 RBd66E06 pGCAP10 NM_018170.3  
GGCTGGTTTGCGGCCGGTCTTGGATGAAGCGGCGGCCGTGGTGAGAGCGTGGGGAAGGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl