Prev. | 

RIKEN DNA Bank Human Resource - RMDN3

Gene ID NCBI Gene 55177 |  KEGG hsa:55177
Gene Symbol RMDN3
Protein Name regulator of microtubule dynamics 3
Synonyms FAM82A2|FAM82C|RMD-3|RMD3|ptpip51
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX056687 IRAK141L23 pCMV-SPORT6 BC063844 NM_018145 Full
HGY084240 IRAL010J24 pOTB7 BC008970 NM_018145 Partial

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR368009 RBd20A09 pGCAP10 NM_018145.1  
GACTGACAGCGTGAGCCCGCGGCGGCTGCTGCCATGGTGGCTGGCGGCCGGGTGCAGCAT
HKR369651 RBd24C03 pGCAP10 NM_018145.1  
GAGCGTGAGCCCGCGGCGGCTGCTGCCATGGTGGCTGGCGGCCGGGTAAGGGTCTGAGTG
HKR416242 RBdS040K02 pGCAP10 NM_018145.1  
GGCGGCGGCTGCTGCCATGGTGGCTGGCGGCCGGGTAAGGGTCTGAGTGGATCTCCTGCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl