Prev. |  KEGG KO K19751 > 

RIKEN DNA Bank Human Resource - DNAAF2

Gene ID NCBI Gene 55172 |  KEGG hsa:55172
Gene Symbol DNAAF2
Protein Name dynein axonemal assembly factor 2
Synonyms C14orf104|CILD10|KTU|PF13
Ortholog resource in our bank

  DNAAF2

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005235 IRAK013B11 pCMV-SPORT6 BC011400 NM_018139 Full/var
HGY087691 IRAL019D19 pDNR-LIB BC013322 NM_018139 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR367229 RBd18B05 pGCAP10 NM_018139.2  
GGGACCTCCAGGATTACCGCTGCTCCAGGGACTCAGCCCCGAGCCCCGTGCCCCATGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl