Prev. |  KEGG KO K19751 > 

RIKEN DNA Bank Human Resource - DNAAF2

Gene ID NCBI Gene 55172 |  KEGG hsa:55172
Gene Symbol DNAAF2
Protein Name dynein axonemal assembly factor 2
Synonyms C14orf104|CILD10|KTU|PF13
Ortholog resources KEGG ortholog (KEGG orthology K19751) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005235 IRAK013B11 pCMV-SPORT6 BC011400 NM_018139 Full/var
HGY087691 IRAL019D19 pDNR-LIB BC013322 NM_018139 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR367229 RBd18B05 pGCAP10 NM_018139.2  
GGGACCTCCAGGATTACCGCTGCTCCAGGGACTCAGCCCCGAGCCCCGTGCCCCATGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl