Prev. |  KEGG KO K11509 > 

RIKEN DNA Bank Human Resource - CENPQ

Gene ID NCBI Gene 55166 |  KEGG hsa:55166
Gene Symbol CENPQ
Protein Name centromere protein Q
Synonyms C6orf139|CENP-Q
Ortholog resources KEGG ortholog (KEGG orthology K11509) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX006073 IRAK015D01 pCMV-SPORT6 BC016279 NM_018132 Full
HGX069844 IRAK174K04 pCMV-SPORT6 BC072444 NM_018132 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE092006 M01C030A06 pDONR221 MGC04-F03 BC016279 NM_018132  
HGE092054 M01C030C06 pDONR221 MGC04-F03 BC016279 NM_018132  
HGE092102 M01C030E06 pDONR221 MGC04-F03 BC016279 NM_018132  
HGE092150 M01C030G06 pDONR221 MGC04-F03 BC016279 NM_018132  
HGE092198 M01C030I06 pDONR221 MGC04-F03 BC016279 NM_018132  
HGE092246 M01C030K06 pDONR221 MGC04-F03 BC016279 NM_018132  
HGE092294 M01C030M06 pDONR221 MGC04-F03 BC016279 NM_018132  
HGE092342 M01C030O06 pDONR221 MGC04-F03 BC016279 NM_018132  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR389748 RBd74G04 pGCAP10 NM_018132.3  
TGGCGGCTCTCAGAAGGGTGCAAGAAGAATCAGTGATCAAGATGTCTGGTAAAGCAAATG
HKR442201 RBdS105I09 pGCAP10 NM_018132.3  
TGACTCTAAGCGCGGCTCTCAGAAGGGTGCAAGAAGAATCAGTGCACTGTGTTTAGATCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl