Prev. |  KEGG KO K17306 > 

RIKEN DNA Bank Human Resource - ARMC1

Gene ID NCBI Gene 55156 |  KEGG hsa:55156
Gene Symbol ARMC1
Protein Name armadillo repeat containing 1
Synonyms Arcp
Ortholog resources KEGG ortholog (KEGG orthology K17306) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081869 IRAL004L05 pOTB7 BC011607 NM_018120

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR078051 ARe95C03 pKA1U5 NM_018120.3  
GGCTTTGGCTCCCTGAGTTAGTCCGGTTGTTTGCGATCGCCGCGGCCGGGGCTGCGAACC
HKR180946 ARi52G02 pGCAP10 NM_018120.3  
GGGCTCCCTGAGTTAGTCCGGTTGTTTGCGATCGCCGCGGCCGGGGCTGCGAACCGAAGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl