Prev. | 

RIKEN DNA Bank Human Resource - MSTO1

Gene ID NCBI Gene 55154 |  KEGG hsa:55154
Gene Symbol MSTO1
Protein Name misato mitochondrial distribution and morphology regulator 1
Synonyms LST005|MMYAT|MST
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066987 IRAK167H19 pBluescriptR BC070067 NM_018116 Full/var
HGY081906 IRAL004M18 pOTB7 BC002535 NM_018116 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR378099 RBd45E03 pGCAP10 NM_018116.2  
TGGGAGCAGCGCAGTATGGCGGGCGGGGCCCGGGAGGTGCTCACACTGCAGTTGGGACAT
HKR461829 RBdS154J13 pGCAP10 NM_018116.2  
GTAGGAGCAGCGAGCGGCGCGGCTGAGGCGCGGCGGCCCCGTGGAGCAGCGCAGTATGGC
HKR461830 RBdS154J14 pGCAP10 NM_018116.2  
GGCAGCGCAGTATGGCGGGCGGGGCCCGGGAGGTGCTCACACTGCAGTTGGGACATTTTG
HKR470804 RBdS177A04 pGCAP10 NM_018116.2  
AGGGAGGCGCGGCGGCCCCGTGGAGCAGCGCAGTATGGCGGGCGGGGCCCGGGAGGTGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl