Prev. | 

RIKEN DNA Bank Human Resource - DALRD3

Gene ID NCBI Gene 55152 |  KEGG hsa:55152
Gene Symbol DALRD3
Protein Name DALR anticodon binding domain containing 3
Synonyms -
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX025676 IRAK064D04 pCMV-SPORT6 BC032440 NM_018114 Full/var
HGX039339 IRAK098F19 pCMV-SPORT6 BC054493 NM_001009996 Full/var
HGX039340 IRAK098F20 pCMV-SPORT6 BC047683 NM_001009996 Full
HGY091582 IRAL028P22 pOTB7 BC014099 NM_018114 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR044479 ARe11D07 pKA1U5 NM_018114.4  
TGGACCATGGCGACCAGGCGCCTTGGGGTCGGGGAGACGCTGGGGGCCCTCAACGCGGCC
HKR366831 RBd17B07 pGCAP10 NM_018114.4  
GCCTTCCGGTCACCATGGCGACCAGGCGCCTTGGGGTCGGGGAGACGCTGGGGGCCCTCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl