Prev. | 

RIKEN DNA Bank Human Resource - TMEM38B

Gene ID NCBI Gene 55151 |  KEGG hsa:55151
Gene Symbol TMEM38B
Protein Name transmembrane protein 38B
Synonyms C9orf87|D4Ertd89e|OI14|TRIC-B|TRICB|bA219P18.1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY028849 IRAK072C01 pBluescriptR BC031938 NM_018112 Partial/var
HGY083102 IRAL007M14 pOTB7 BC000049 NM_018112 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331748 RBb29G04 pGCAP1 NM_018112.1  
GACTCCTCACCGCGCGAGCGCGGGGAACCAGTAGCCGCGGCTGCTTCGGTTGCCGCGGTC
HKR335260 RBb38C12 pGCAP1 NM_018112.1  
TGGTCTCACCGCGCGCGCGCGGGGAACCAGTAGCCGCGGCTGCTTCGGTTGCCGCGGTCG
HKR386826 RBd67B02 pGCAP10 NM_018112.1  
GCTCCTCACCGCGCGCGCGCGGGGAACCAGTAGCCGCGGCTGCTTCGGTTGCCGCGGTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl