Prev. |  KEGG KO K20003 > 

RIKEN DNA Bank Human Resource - ZDHHC4

Gene ID NCBI Gene 55146 |  KEGG hsa:55146
Gene Symbol ZDHHC4
Protein Name zinc finger DHHC-type palmitoyltransferase 4
Synonyms ZNF374
Ortholog resource in our bank

  ZDHHC4

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001852 IRAK004K12 pCMV-SPORT6 BC001239 NM_018106 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006013 W01A015A13 pENTR-TOPO IRAK004K12 BC001239 NM_018106  
HGE006015 W01A015A15 pENTR-TOPO IRAK004K12 BC001239 NM_018106  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR070084 ARe75D12 pKA1U5 NM_018106.3  
ATCCTGGCCTTTCCCCTTGTGTGTAGGGCCGCCGTTNCCACCCCCACCTCGCCGGAGTCC
HKR071706 ARe79E10 pKA1U5 NM_018106.3  
GATCGCGCCCGGGAGGCGCCGGAGCCCAGCGGCTGGCGGGCCGCCGTCCCACCCCCACCT
HKR345775 RBb64H07 pGCAP1 NM_018106.3  
TGGCGCCCGGGAGGCGCCGGAGCCCAGCGGCTGGCGCCAGATCCAGGCTCCTGGAAGAAC
HKR394552 RBd86G08 pGCAP10 NM_018106.3  
TGGCGCCCGGGAGGCGCCGGAGCCCAGCGGCTGGCGGGCCGCCGTCCCACCCCCACCTCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl