Prev. |  KEGG KO K11514 > 

RIKEN DNA Bank Human Resource - CDCA8

Gene ID NCBI Gene 55143 |  KEGG hsa:55143
Gene Symbol CDCA8
Protein Name cell division cycle associated 8
Synonyms BOR|BOREALIN|DasraB|MESRGP
Ortholog resources KEGG ortholog (KEGG orthology K11514) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008041 IRAK020B17 pCMV-SPORT6 BC016944 NM_018101 Full/var
HGY081161 IRAL002P01 pOTB7 BC001651 NM_018101 Full
HGY082370 IRAL005P10 pOTB7 BC000703 NM_018101 Full
HGY084247 IRAL010K07 pOTB7 BC008079 NM_018101 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248892 ARiS122D20 pGCAP10 NM_018101.2  
GGAGGTTTTGCTCAGCCCTTGTCTCGGGACCGCAGGTACGTGCCTGGCGACTTCTTCGGG
HKR369612 RBd24A12 pGCAP10 NM_018101.2  
GGCTCTCTCTCACTGGCACAGCGAGGTTTTGCTCAGCCCTTGTCTCGGGACCGCAGGTAC
HKR385607 RBd64A07 pGCAP10 NM_018101.2  
GGCTCAGCCCTTGTCTCGGGACCGCAGGTACGTGCCTGGCGACTTCTTCGGGTGGTCCCC
HKR386156 RBd65G12 pGCAP10 NM_018101.2  
GGGCACAGCGAGGTTTTGCTCAGCCCTTGTCTCGGGACCGCAGGTACGTGCCTGGCGACT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl