Prev. |  KEGG KO K19327 > 

RIKEN DNA Bank Human Resource - ANO10

Gene ID NCBI Gene 55129 |  KEGG hsa:55129
Gene Symbol ANO10
Protein Name anoctamin 10
Synonyms SCAR10|TMEM16K
Ortholog resources KEGG ortholog (KEGG orthology K19327) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX032912 IRAK082E16 pCMV-SPORT6 BC038855 NM_018075 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR052569 ARe31H01 pKA1U5 NM_018075.3  
GGCCCGGCCTCCGGTTCTCGCCGGCTCTCGGACCCGCCTCCGAAGACGTGGAGCGCTGCG
HKR068527 ARe71F07 pKA1U5 NM_018075.3  
GNNCNNTNCCTGCCGGANACTCTCANTGGCTCCNGCNTTTTGGACTNNCCNCCGTTCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_210404.csv
NRCDhumcloneList_RB_210404.csv


2021.04.07

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_210329.pl