Prev. |  KEGG KO K19327 > 

RIKEN DNA Bank Human Resource - ANO10

Gene ID NCBI Gene 55129 |  KEGG hsa:55129
Gene Symbol ANO10
Protein Name anoctamin 10
Synonyms SCAR10|TMEM16K
Ortholog resource in our bank

  ANO10

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX032912 IRAK082E16 pCMV-SPORT6 BC038855 NM_018075 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR052569 ARe31H01 pKA1U5 NM_018075.3  
GGCCCGGCCTCCGGTTCTCGCCGGCTCTCGGACCCGCCTCCGAAGACGTGGAGCGCTGCG
HKR068527 ARe71F07 pKA1U5 NM_018075.3  
GNNCNNTNCCTGCCGGANACTCTCANTGGCTCCNGCNTTTTGGACTNNCCNCCGTTCGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl