Prev. |  KEGG KO K10606 > 

RIKEN DNA Bank Human Resource - FANCL

Gene ID NCBI Gene 55120 |  KEGG hsa:55120
Gene Symbol FANCL
Protein Name Fanconi anemia complementation group L
Synonyms FAAP43|PHF9|POG
Ortholog resources KEGG ortholog (KEGG orthology K10606) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX005443 IRAK013K03 pCMV-SPORT6 BC009042 NM_018062 Full
HGX044027 IRAK110B03 pCMV-SPORT6 BC054517 NM_018062 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE006180 W01A015H12 pENTR-TOPO IRAK110B03 BC054517 NM_018062  
HGE006182 W01A015H14 pENTR-TOPO IRAK110B03 BC054517 NM_018062  
HGE006184 W01A015H16 pENTR-TOPO IRAK110B03 BC054517 NM_018062  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR041673 ARe04D01 pKA1U5 NM_018062.3  
TGAGGTCTAGAGCTTTTCTGTGTTTCTCCGGACTTCGAGCCATGGCGGTGACGGAAGCGA
HKR322572 RBb06H04 pKA1U5 NM_018062.3  
ATCCTGACTTCGAGCCATGGCGGTGACGGAAGCGAGCCTGTTGCGCCAGTGCCCCCTGCT
HKR393706 RBd84E10 pGCAP10 NM_018062.3  
GACTTCGAGCCATGGCGGTGACGGAAGCGAGCCTGTTGCGCCAGTGCCCCCTGCTTCTGC
HKR408896 RBdS022D24 pGCAP10 NM_018062.3  
TCTACCCCCTAAGTTCGTTGAAATTGCTAAGAGAAGTGTTTCTATGTCCAACTTGTCACA
HKR444077 RBdS110D05 pGCAP10 NM_018062.3  
GGGACTTCGAGCCATGGCGGTGACGGAAGCGAGCCTGTTGCGCCAGTGCCCCCTGCTTCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl