Prev. |  KEGG KO K20638 > 

RIKEN DNA Bank Human Resource - ARHGAP17

Gene ID NCBI Gene 55114 |  KEGG hsa:55114
Gene Symbol ARHGAP17
Protein Name Rho GTPase activating protein 17
Synonyms MST066|MST110|MSTP038|MSTP066|MSTP110|NADRIN|PP367|PP4534|RICH-1|RICH1|WBP15
Ortholog resource in our bank

  ARHGAP17

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX069886 IRAK174L22 pCMV-SPORT6 BC080195 NM_018054 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR043231 ARe08B07 pKA1U5 NM_018054.4 done
GGCCGTTTGGGCCGGGAAGCGATGTAGTAGCTGCCAGGCTGCTCCCCCGCCCTGCCCGGC
HKR235000 ARiS087I08 pGCAP10 NM_018054.4  
GGAGCCNCCNCCNCGCCGCCGTTTGGGCCGGGAAGCGATGTAGTAGCTGCCAGGCTGTCC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl