Prev. | 

RIKEN DNA Bank Human Resource - PLEKHJ1

Gene ID NCBI Gene 55111 |  KEGG hsa:55111
Gene Symbol PLEKHJ1
Protein Name pleckstrin homology domain containing J1
Synonyms GNRPX
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081431 IRAL003J15 pOTB7 BC003084 NM_018049 Full
HGY084069 IRAL010C21 pOTB7 BC008966 NM_018049 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR219788 ARiS049H20 pGCAP10 NM_018049.1  
GCCGGCCCCAGCCTGAGCGGGGACGGCGGCCGGGAGGGCGCGGCCCGGGTTCCCGTTCCC
HKR331249 RBb28C01 pGCAP1 NM_018049.1  
GCGGGGCCTCAGGATGCACAAGGCCGGACGCTCACGGGAGGAGGGAGGGGAGCGACGCCG
HKR336552 RBb41G08 pGCAP1 NM_018049.1  
TGCCCGTTCCCCGCGGAGCCATGCGGTACAACGAGAAGGAGCTGCAGGCTCTGTCCCGGC
HKR380880 RBd52D08 pGCAP10 NM_018049.1  
GCAGCCTGAGCGGGGACGGCGGCCGGGAGGGCGCGGCCCGGGTTCCCGTTCCCCGCGGAG
HKR471025 RBdS177J09 pGCAP10 NM_018049.1  
GGACATTTTTGGCGCCGGCCCCAGCCTGAGCGGGGACGGCGGCCGGGAGGGCGCGGCCCG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl