Prev. |  KEGG KO K12877 > 

RIKEN DNA Bank Human Resource - MAGOHB

Gene ID NCBI Gene 55110 |  KEGG hsa:55110
Gene Symbol MAGOHB
Protein Name mago homolog B, exon junction complex subunit
Synonyms MGN2|mago|magoh
Ortholog resource in our bank

  MAGOHB

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY087873 IRAL019L09 pDNR-LIB BC010905 NM_018048 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004196 W01A010I04 pENTR-TOPO IRAL019L09 BC010905 NM_018048  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR062504 ARe56E08 pKA1U5 NM_018048.2  
GGATGACGTCACTGCAAGGCGCCGGGGGACACGCCTGNCANGCGCTTTTCGGCGGGCTTC
HKR369250 RBd23C02 pGCAP10 NM_018048.2  
GGACGTCGNCTCCGAGGGCCNCGNGACACGGTGGGCCGCGTTTGAGAAAANNTTGNCGGG
HKR433316 RBdS083E20 pGCAP10 NM_018048.2  
GATTCCGCGCGATGACGTCACTGCAAGGCGCCGGGGGACACGTTGGCTGCGTTTTCGGCG
HKR444111 RBdS110E15 pGCAP10 NM_018048.2  
GACAAAAATGGCTGTGGCTAGCGATTTCTACCTGCGCTACTACGTAGGGCACAAGGGCAA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl