Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AGGF1

Gene ID (NCBI) 55109
Gene Symbol AGGF1
Protein Name angiogenic factor with G patch and FHA domains 1
Synonyms GPATC7|GPATCH7|HSU84971|HUS84971|VG5Q
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGY019064 IRAK047K24 pBluescriptR BC032844 NM_018046 Full/var
HGX066503 IRAK166E07 pCMV-SPORT6 BC073864 NM_018046 Partial/var
HGY096450 IRAL041C02 pDNR-LIB BC029382 NM_018046 Partial/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_170405.csv
GNP_full_IRAL_170405.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE014241 W01A035K01 pENTR-TOPO IRAL041C02 BC029382 NM_018046  
HGE014245 W01A035K05 pENTR-TOPO IRAL041C02 BC029382 NM_018046  

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR166003 ARi15A03 pGCAP10 NM_018046.3  
GGTTGTTTCCGGCTCAACTGGGGAGCTGCTGGAGCTCTTCTGGCCTCTGGTTTTCCGACT
HKR321231 RBb03B07 pKA1U5 NM_018046.3  
GGGGGCCACCGCGGCCAGCCGGGTGTGAGGCTGCCTTTCGCTGCCCGCGCGCTCCAGTGG
HKR382123 RBd55F03 pGCAP10 NM_018046.3  
GGCTGGCGCCGTTGTTTCCGGCTCAACTGGGGAGCTGCTGGNGNTCTTCTGGCCTCTGGT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2017.08.28

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_170416.pl