Prev. |  KEGG KO K13123 > 

RIKEN DNA Bank Human Resource - GPATCH1

Gene ID NCBI Gene 55094 |  KEGG hsa:55094
Gene Symbol GPATCH1
Protein Name G-patch domain containing 1
Synonyms ECGP|GPATC1
Ortholog resources KEGG ortholog (KEGG orthology K13123) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY087230 IRAL018B06 pOTB7 BC006108 NM_018025

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR066077 ARe65D05 pKA1U5 NM_018025.2  
GCGGAAGAGCAGGATGGCGGCGCGGGACAGTGACAGCGAAGAAGATCTGGTCAGCTATGG
HKR475170 RBdS187P10 pGCAP10 NM_018025.2  
GAGGATGGCGGCGCGGGACAGTGACAGCGAAGAAGATCTGGTCAGCTATGGGACCGGGCT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl