Prev. | 

RIKEN DNA Bank Human Resource - UACA

Gene ID NCBI Gene 55075 |  KEGG hsa:55075
Gene Symbol UACA
Protein Name uveal autoantigen with coiled-coil domains and ankyrin repeats
Synonyms NUCLING
Links

  KEGG gene

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR249182 ARiS122P22 pGCAP10 NM_018003.2  
ATTTTAACTGAATTTCGGCACACAGATGACTTAAATTAGCTACACTGGCCTGGGAAGAAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2021.03.25

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl