Prev. |  KEGG KO K11974 > 

RIKEN DNA Bank Human Resource - RNF31

Gene ID NCBI Gene 55072 |  KEGG hsa:55072
Gene Symbol RNF31
Protein Name ring finger protein 31
Synonyms HOIP|Paul|ZIBRA
Ortholog resource in our bank

  RNF31

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY089642 IRAL024B18 pOTB7 BC017376 NM_017999 Partial/var
HGY090198 IRAL025I06 pOTB7 BC009821 NM_017999 Partial/var
HGY091959 IRAL029O23 pOTB7 BC012077 NM_017999 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR328150 RBb20G06 pKA1U5 NM_017999.4  
GCCTAGATACTTCCTGTTCTCGGCTAACCCTGGCGCTGGGCCGGGGGCTGGAGAGTGACC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl