Prev. | 

RIKEN DNA Bank Human Resource - TMEM248

Gene ID NCBI Gene 55069 |  KEGG hsa:55069
Gene Symbol TMEM248
Protein Name transmembrane protein 248
Synonyms C7orf42
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX005243 IRAK013B19 pCMV-SPORT6 BC008675 NM_017994 Full
HGX007760 IRAK019G16 pCMV-SPORT6 BC010519 NM_017994 Full/var
HGX008028 IRAK020B04 pCMV-SPORT6 BC041764 NM_017994 Full
HGY087978 IRAL019P18 pDNR-LIB BC012562 NM_017994 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR173721 ARi34F01 pGCAP10 NM_017994.4  
TCCCGGAAACCGCGGTTGCCGGAGCCCGAACTGAGGCGGCGGCGGGAGCCCGGTTGGCGT
HKR395253 RBd88C05 pGCAP10 NM_017994.4  
CGGCCGGCCGATGACCCGGAAACCGCGGTTGCCGGAGCCCGAACTGAGGCGGCGGCGGGA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl