Prev. |  KEGG KO K11579 > 

RIKEN DNA Bank Human Resource - ZWILCH

Gene ID NCBI Gene 55055 |  KEGG hsa:55055
Gene Symbol ZWILCH
Protein Name zwilch kinetochore protein
Synonyms KNTC1AP|hZwilch
Ortholog resource in our bank

  ZWILCH

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031569 IRAK078P09 pCMV-SPORT6 BC036900 NM_017975 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR389602 RBd74A02 pGCAP10 NM_017975.3  
GGGCGGTTCCGGTACCGCTCTCACATTGGGGCGGGATGTGGGAGCGGCTGAACTGCGCAG
HKR406184 RBdS015H16 pGCAP10 NM_017975.3  
GCCCTGACGTCGCCGGTCCGGCGCGCAGTTCAGTTTGGCGGTTCCGGTACCGCTCTCACA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl