Prev. | 

RIKEN DNA Bank Human Resource - CDCA4

Gene ID NCBI Gene 55038 |  KEGG hsa:55038
Gene Symbol CDCA4
Protein Name cell division cycle associated 4
Synonyms HEPP|SEI-3/HEPP
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY091177 IRAL027P17 pOTB7 BC011736 NM_145701 Full
HGY096991 IRAL042H23 pOTB7 BC025263 NM_145701 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR064898 ARe62E02 pKA1U5 NM_017955.3  
GGCTCAGCGGCGGGAAGCTGGCGGCAGCGGCGGTGGCGGTGGCTGAGCAGAGGACCCGGC
HKR070031 ARe75B07 pKA1U5 NM_017955.3  
GGGCGGCAGCGGCGGTGGCGGTGGCTGAGCAGAGGACCCGGCGGGCGGCCTCGCGGGTCA
HKR321321 RBb03F01 pKA1U5 NM_017955.3  
GGCTCCTTCCTCAGCGGCGGGAAGCTGGCGGCAGCGGCGGTGGCGGTGGCTGAGCAGAGG
HKR345653 RBb64C05 pGCAP1 NM_017955.3  
TGGGGCGCTCCTTCCTCAGCGGCGGGAAGCTGGCGGCAGCGGCGGTGGCGGTGGCTGAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl