Prev. |  KEGG KO K15274 > 

RIKEN DNA Bank Human Resource - SLC35A5

Gene ID NCBI Gene 55032 |  KEGG hsa:55032
Gene Symbol SLC35A5
Protein Name solute carrier family 35 member A5
Synonyms -
Ortholog resource in our bank

  SLC35A5

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001530 IRAK003N18 pCMV-SPORT6 BC010307 NM_017945
HGX008690 IRAK021M02 pCMV-SPORT6 BC013046 NM_017945 Full
HGY086471 IRAL016C23 pDNR-LIB BC005207 NM_017945 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE006897 W01A017E01 pENTR-TOPO IRAK003N18 BC010307 NM_017945  
HGE006899 W01A017E03 pENTR-TOPO IRAK003N18 BC010307 NM_017945  
HGE006901 W01A017E05 pENTR-TOPO IRAK003N18 BC010307 NM_017945  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR409115 RBdS022N03 pGCAP10 NM_017945.2  
GGTCGGGTCCGCTTTTTCCCAATCCGGACGTAATCGTGGTTTTTGTTCTGCAATAGGCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl