Prev. |  KEGG KO K10311 > 

RIKEN DNA Bank Human Resource - FBXO34

Gene ID NCBI Gene 55030 |  KEGG hsa:55030
Gene Symbol FBXO34
Protein Name F-box protein 34
Synonyms CGI-301|Fbx34
Ortholog resource in our bank

  FBXO34

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR247358 ARiS118G14 pGCAP10 NM_017943.2 Full done
GGGTCCGACTCAGCGGTGGGGAGTGAGCCAGGCCTCCCGCCACCGCTGCTGCCGCCACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.10

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl