Prev. | 

RIKEN DNA Bank Human Resource - PIH1D1

Gene ID NCBI Gene 55011 |  KEGG hsa:55011
Gene Symbol PIH1D1
Protein Name PIH1 domain containing 1
Synonyms NOP17
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY081307 IRAL003E11 pOTB7 BC001108 NM_017916 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR248827 ARiS122B03 pGCAP10 NM_017916.1  
GGTTTACAGTTCGGCACGTAGGACGGAGGGTAGTGCGTCTAGAGACACATATTCCCCACG
HKR249166 ARiS122P06 pGCAP10 NM_017916.1  
GACAGTTCGGCACGTAGGACGGAGGGTAGTGCGTCTAGAGACACATATTCCCAACGGATT
HKR276772 ARiS191P12 pGCAP10 NM_017916.1  
AGGTTTACAGTTCGGCACGTAGGACGGAGGGTAGTGCGTCTAGAGACACATATTCCCCAC
HKR332878 RBb32D06 pGCAP1 NM_017916.1  
GGTTTACAGTTCGGCACGTAGGACGGAGGGTAGTGCGTCTAGAGACACATATTCCCCACG
HKR335331 RBb38F11 pGCAP1 NM_017916.1  
TGGCGGTCTAGAGACACATATTCCCCACGGATTTGACGATGGTGTTTCGGTCTTGAATGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl