Prev. | 

RIKEN DNA Bank Human Resource - FAM118A

Gene ID NCBI Gene 55007 |  KEGG hsa:55007
Gene Symbol FAM118A
Protein Name family with sequence similarity 118 member A
Synonyms C22orf8
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX008519 IRAK021E23 pCMV-SPORT6 BC013696 NM_017911 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR360906 RBd02E10 pGCAP10 NM_017911.2  
GGTAGCCGGTCGCGGAGGCGAAGAGGTGGCAGCGCGAGCTGGGACCAGCGTCTCGGAGGC
HKR408828 RBdS022B04 pGCAP10 NM_017911.2  
GGTAGCCGGCTGCGGAGGCGAAGAGGTGGCAGCGCGAGCTGGGACCAGCGTCTCGGAGGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl