Prev. | 

RIKEN DNA Bank Human Resource - TMCO3

Gene ID NCBI Gene 55002 |  KEGG hsa:55002
Gene Symbol TMCO3
Protein Name transmembrane and coiled-coil domains 3
Synonyms C13orf11
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY066902 IRAK167E06 pBluescriptR BC068515 NM_017905
HGY087683 IRAL019D11 pDNR-LIB BC012564 NM_017905 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR174034 ARi35B10 pGCAP10 NM_017905.4  
GGAGCGGGGGCGGTGCTGGGCAGGGCGGCGGCCGCTCCCTCCCGGACTCCCGGCCTCCCG
HKR372456 RBd31C08 pGCAP10 NM_017905.4  
CGGCCGGCCGATGGGGAGTCCGGGTCGGCTTGGCTGAGCGGGGGCGGTGCTGGGCAGGGC
HKR386553 RBd66G09 pGCAP10 NM_017905.4  
GGGTCNNNTTGGCTGAGCGGGGGCGGTGCTGGGCAGGGCGGCGGCCGCTCCCTCCCGGAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl