RIKEN DNA Bank Human Resource - AURKAIP1
|
Ortholog resource in our bank AURKAIP1 External database KEGG gene KEGG Ortholog NCBI Gene |
Genome Network Project (GNP) Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | Sequence submitted (DDBJ)(1) | CDS comparison | |
|---|---|---|---|---|---|
| Refered (NCBI mRNA) | CDS status(2) | ||||
| HGX027359 | IRAK068G15 | pCMV-SPORT6 | BC035595 | NM_017900 | Partial |
| HGX037249 | IRAK093C01 | pCMV-SPORT6 | BC046345 | NM_017900 | |
| HGY097094 | IRAL042M06 | pOTB7 | BC022808 | NM_017900 | Full |
| HGY100246 | IRAL050K06 | pOTB7 | BC062333 | NM_017900 | Full |
(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.
GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv
Genome Network Project (GNP) Gateway® Entry Clone
Plasmid request [in Japanese] [in English]
W series
| Catalog number | Clone name | Vector | Constructed from(1) | CDS comparison | Status | ||
|---|---|---|---|---|---|---|---|
| Clone ID | Sequence (DDBJ) | Refered mRNA | CDS status | ||||
| HGE004550 | W01A011G06 | pENTR-TOPO | IRAL050K06 | BC062333 | NM_017900 | ||
♦ W series clone contains a stop codon.
GNP_entry_W01A_2023Apr24.csv
♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
NRCD Human cDNA Clone
Plasmid request [in Japanese] [in English]
| Catalog number | Clone name | Vector | CDS comparison | Status | |
|---|---|---|---|---|---|
| Refered mRNA(1) | CDS status | ||||
| 5'-terminal sequence(2) | |||||
| HKR164049 | ARi10C01 | pGCAP10 | NM_017900.2 | ||
| GGGACCGGAAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCC | |||||
| HKR243949 | ARiS109O13 | pGCAP10 | NM_017900.2 | ||
| GGGACCGGNANTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCC | |||||
| HKR322154 | RBb05G10 | pKA1U5 | NM_017900.2 | ||
| GAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGANCCGCGTCGAGGTCGGGCTTGGGA | |||||
| HKR331370 | RBb28H02 | pGCAP1 | NM_017900.2 | ||
| TGAAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGA | |||||
| HKR345372 | RBb63H04 | pGCAP1 | NM_017900.2 | ||
| GGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGGTCGGGCTTGGGAAGGGTCAGCGG | |||||
| HKR347726 | RBb69F06 | pGCAP1 | NM_017900.2 | ||
| TGGGACCGGAAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCC | |||||
| HKR360899 | RBd02E03 | pGCAP10 | NM_017900.2 | ||
| GGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGACCTGTGGCCGCCGCCCACA | |||||
| HKR430319 | RBdS075N07 | pGCAP10 | NM_017900.2 | ||
| AGAACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGACCTGTGGCCGCCGCCCACAGAC | |||||
| HKR470834 | RBdS177B10 | pGCAP10 | NM_017900.2 | ||
| GACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGACCTGTGGCCGCCGCCCACAGACCA | |||||
♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.
NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv
♦ No Approval Forms Required for Fluorescent Protein Genes Developed by Dr. Atsushi Miyawaki
♦ RIKEN BRC will be closed from December 28, 2024 through January 5, 2025 due to New Year's holidays.
♦ A bicistronic cell cycle reporter, Fucci2a (Sep 17, 2024)
♦ Monomeric Fluorescent Protein Resource, mStayGold (Dec 18, 2023)
♦ Visualization of Organelles update (Dec 18, 2023)
♦ Development of two mouse strains conditionally expressing bright luciferases (Sep 08, 2023)
♦ Autophagy and Mitophagy Updates (Aug 16, 2023)
♦ High intensity forms of luciferase and luminescent proteins from various organisms (BRC RESOURCE NEWS) (Apr 28, 2023)
♦ Plasmid of Cas9 expression/mRNA production, evaluation of the genome edit efficiency, and Knock-in donors and tags
♦ Fucci cell cycle indicator, Calcium sensor and Fluorescent and Luminescent protein resources
♦ Revision of Distribution Fees for Bioresources in RIKEN BRC
- - - - - - - - - - - - - - - - - - - -
♦ Mail News sign-up. Receive information of the forcusd resources, new available resources and more.
♦ Please visit "Terms of Use", "Quality control" and "Ordering instruction"
2023.05.08
Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl