Prev. | Human A to Z list > A > 

RIKEN DNA Bank Human Resource - AURKAIP1

Gene ID (NCBI) 54998
Gene Symbol AURKAIP1
Protein Name aurora kinase A interacting protein 1
Synonyms AIP|AKIP|MRP-S38
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX027359 IRAK068G15 pCMV-SPORT6 BC035595 NM_017900 Partial
HGX037249 IRAK093C01 pCMV-SPORT6 BC046345 NM_017900
HGY097094 IRAL042M06 pOTB7 BC022808 NM_017900 Full
HGY100246 IRAL050K06 pOTB7 BC062333 NM_017900 Full

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


Genome Network Project (GNP) Gateway® Entry Clone link 01

W series

Catalog number Clone name Vector Constructed from(1) Refered mRNA
Clone ID Sequence (DDBJ)
HGE004550 W01A011G06 pENTR-TOPO IRAL050K06 BC062333 NM_017900

♦ W series clone contains a stop codon.

GNP_entry_W01A_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com/site/us/en/home.html


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR164049 ARi10C01 pGCAP10 NM_017900.2
GGGACCGGAAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCC
HKR243949 ARiS109O13 pGCAP10 NM_017900.2
GGGACCGGNANTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCC
HKR322154 RBb05G10 pKA1U5 NM_017900.2
GAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGANCCGCGTCGAGGTCGGGCTTGGGA
HKR360899 RBd02E03 pGCAP10 NM_017900.2
GGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGACCTGTGGCCGCCGCCCACA
HKR331370 RBb28H02 pGCAP1 NM_017900.2
TGAAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGA
HKR345372 RBb63H04 pGCAP1 NM_017900.2
GGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGGTCGGGCTTGGGAAGGGTCAGCGG
HKR347726 RBb69F06 pGCAP1 NM_017900.2
TGGGACCGGAAGTGCCCGAGGGCGGCCGCAGAACGGTCAATTTGAGCCGCGTCGAGCTCC
HKR430319 RBdS075N07 pGCAP10 NM_017900.2
AGAACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGACCTGTGGCCGCCGCCCACAGAC
HKR470834 RBdS177B10 pGCAP10 NM_017900.2
GACGGTCAATTTGAGCCGCGTCGAGCTCCCCTGGGACCTGTGGCCGCCGCCCACAGACCA

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl