Prev. | Human A to Z list > G > 

RIKEN DNA Bank Human Resource - GID8

Gene ID (NCBI) 54994
Gene Symbol GID8
Protein Name GID complex subunit 8
Synonyms C20orf11|TWA1
Databases KEGG link 01 |  NCBI Gene link 01


Genome Network Project (GNP) Human Full-Length cDNA Clone link 01

Catalog number Clone name Vector(1) Sequence CDS status(3)
Submitted (DDBJ)(2) Refered (NCBI mRNA)
HGX011628 IRAK029B04 pCMV-SPORT6 BC031819 NM_017896 Partial/var
HGY095664 IRAL039C16 pOTB7 BC032120 NM_017896 Full/var

(1) Extra 1,250 YEN (license fee) is required for Gateway® Expression Clone (pCMV SPORT6 and related vectors).
(2) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(3) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_160505.csv
GNP_full_IRAL_160505.csv


NRCD Human Full-Legth cDNA Clone link 01

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1)
5'-terminal sequence(2)
HKR234945 ARiS087G01 pGCAP10 NM_017896.2
GGCTGCNGAGCCGCANCCGCCCAGACCGCGCAGCGCGGGAGGCAGGTTCCGCACGAAAT
HKR405310 RBdS013E14 pGCAP10 NM_017896.2
GACCTCTGCCTCCTTCTACTCGGGCGCCCCGGCGGCCGCCACCTCTCCCCAGCCCAGGAG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2016.08.10

Homo_sapiens_gene_info140110 - RDB_hum_GIxxxxxxxxx_html_160505.pl