Prev. | 

RIKEN DNA Bank Human Resource - HCFC1R1

Gene ID NCBI Gene 54985 |  KEGG hsa:54985
Gene Symbol HCFC1R1
Protein Name host cell factor C1 regulator 1
Synonyms HPIP
Links

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX055881 IRAK139L17 pCMV-SPORT6 BC065514 NM_001002017 Partial
HGX056561 IRAK141G17 pCMV-SPORT6 BC064026 NM_017885 Full
HGY103975 IRAL059P15 pOTB7 BC080178 NM_001002017 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR040927 ARe02F07 pKA1U5 NM_017885.2  
GCTGGACGCCAGCTCCCCTCTCCGAGGAGCTGTGCCCATGAGCACCAAGCGGCGCCTGGA
HKR042979 ARe07H11 pKA1U5 NM_017885.2  
GGGCTGAGGGTCGAGACTTCCGAGGTACCCTGCTGGATGGTCCAGGAGAGCGGGGACCGG
HKR047723 ARe19F03 pKA1U5 NM_017885.2  
ATCCTGTGGCAGCAGCCCTTGCAGCGAGGCCCCCAGGGAGGGGCCCAGCGCCTCCCGCGG
HKR053631 ARe34B07 pKA1U5 NM_017885.2  
AATGATCCTGCAGCAGCCCTTGCAGCGAGGCCCCCAGGGAGGGGCCCAGCGCCTCCCGCG
HKR173631 ARi34B07 pGCAP10 NM_017885.2  
AGATCCCACCCGCAGGACCCCAAAACCCAATGATCCTGCAGCAGCCCTTGCAGCGAGGCC
HKR234846 ARiS087B22 pGCAP10 NM_017885.2  
GTCAGTATCCCAGCCTGCCTCTCTGCCATCTCTCCCCAGGGAGCCTCTGCGCAAGCAGTT
HKR360436 RBd01B12 pGCAP10 NM_017885.2  
GGCAACCTCCCGAGGCCTTACGTGCCTAGAGCGGTTCCTCTCCGTGGCGCCCTACCGCCT
HKR409047 RBdS022K07 pGCAP10 NM_017885.2  
GGCGCGCGACGCAACCTCACGAGGCCTTACGTGCCTAGAGCGGTTCCTCTCCGTGGCGCC
HKR442011 RBdS105A11 pGCAP10 NM_017885.2  
GAGACGGGCGGCGCGTGGCGGAAGGCAGGCTTGCTCCTCGGGGTGGGGGAGGGTATCCGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl