Prev. |  KEGG KO K11135 > 

RIKEN DNA Bank Human Resource - PINX1

Gene ID NCBI Gene 54984 |  KEGG hsa:54984
Gene Symbol PINX1
Protein Name PIN2 (TERF1) interacting telomerase inhibitor 1
Synonyms Gno1|LPTL|LPTS|Pxr1
Ortholog resource in our bank

  PINX1

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX009106 IRAK022M18 pCMV-SPORT6 BC015479 NM_017884 Full/var
HGX035069 IRAK087L05 pCMV-SPORT6 BC043573 NM_017884 Partial/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE037438 W01A093J22 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE037466 W01A093L02 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE037468 W01A093L04 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE037474 W01A093L10 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE037765 W01A094G21 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE037793 W01A094I01 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE037797 W01A094I05 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE046205 W01A115I13 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE046211 W01A115I19 pENTR-TOPO IRAK022M18 BC015479 NM_017884  
HGE046213 W01A115I21 pENTR-TOPO IRAK022M18 BC015479 NM_017884  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR222218 ARiS055J02 pGCAP10 NM_017884.4  
GAGTCCGCCGGCGAGGGAGTTACGCACGTCCTGATTCTCCTGGAGTCTCCAGCCCGCCCA
HKR345702 RBb64E06 pGCAP1 NM_017884.4  
GGCCCCCTCGCCGCCGCGTGCTCGAGGAGCGAGTCGCGCGCTACTGACGTCACCAGCACG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl