Prev. |  KEGG KO K12359 > 

RIKEN DNA Bank Human Resource - CLN6

Gene ID NCBI Gene 54982 |  KEGG hsa:54982
Gene Symbol CLN6
Protein Name CLN6, transmembrane ER protein
Synonyms CLN4A|HsT18960|nclf
Ortholog resources KEGG ortholog (KEGG orthology K12359) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGX011416 IRAK028I24 pCMV-SPORT6 BC013130 NM_017882 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR321324 RBb03F04 pKA1U5 NM_017882.1  
GCCCGAACCGCCCCGCGCTGGGAATTTGCGGCGGCCTCCGCCGGGGCAGCCGAGCTGAAC
HKR384152 RBd60G08 pGCAP10 NM_017882.1  
GGCCGGCCCGCCCCGAACCGCCCCGCGCTGGGAATTTGCGGCGGCCTCCGCCGGGGCAGC
HKR387679 RBd69D07 pGCAP10 NM_017882.1  
GGCGCTGGGAATTTGCGGCGGCCTCCGCCGGGGCAGCCGAGCTGAACCGGTCTCTTCCTC
HKR390976 RBd77H08 pGCAP10 NM_017882.1  
GGTCCGCAGCCCCGCCTGTTCCTCCCGAGGGCCGCGCGCTCTCGCCGGCCCGCCCCGAAC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl