Prev. |  KEGG KO K15118 > 

RIKEN DNA Bank Human Resource - SLC25A38

Gene ID NCBI Gene 54977 |  KEGG hsa:54977
Gene Symbol SLC25A38
Protein Name solute carrier family 25 member 38
Synonyms SIDBA2
Ortholog resource in our bank

  SLC25A38

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX010433 IRAK026B09 pCMV-SPORT6 BC013194 NM_017875 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE005530 W01A013N18 pENTR-TOPO IRAK026B09 BC013194 NM_017875  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR331777 RBb29H09 pGCAP1 NM_017875.2  
GGCGCCCGTCGACGGCACCCTGGGCCCAGAGGACTCGCGGGCCTCATCTCCAATGATTCA
HKR366521 RBd16F01 pGCAP10 NM_017875.2  
GACGGTGCTGAAGCCTGCAGCAGGGCAGGATGGGCAGGAGAGCAGAGCCGCGGAGTCTGC
HKR384054 RBd60C06 pGCAP10 NM_017875.2  
GAGAGTTCCTCCGGCGCTTCCTCCACCCCGGGATACACAGAACCTCATCTCCTACGGTGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl