Prev. |  KEGG KO K13148 > 

RIKEN DNA Bank Human Resource - INTS11

Gene ID NCBI Gene 54973 |  KEGG hsa:54973
Gene Symbol INTS11
Protein Name integrator complex subunit 11
Synonyms CPSF3L|CPSF73L|INT11|RC-68|RC68
Ortholog resource in our bank

  INTS11

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGY082180 IRAL005H12 pOTB7 BC000675 NM_017871 Partial
HGY089740 IRAL024F20 pOTB7 BC007978 NM_017871 Full
HGY089851 IRAL024K11 pOTB7 BC013904 NM_032179 Partial/var
HGY089868 IRAL024L04 pOTB7 BC008041 NM_017871 Full/var
HGY096153 IRAL040G09 pOTB7 BC020199 NM_017871 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR182427 ARi56B03 pGCAP10 NM_017871.4  
GGCGGGTCCGGGAGCGCGGCGGAGACGATGCCTGAGATCAGAGTCACGCCCTTGGGACGT
HKR219976 ARiS049P16 pGCAP10 NM_017871.4  
GGCAGTGCATCACCGCAGGCGGGCCTCGCGGGTCCGGGAGCGCGGCGGAGACGATGCCTG
HKR396004 RBd90A04 pGCAP10 NM_017871.4  
GCTCTCTCGCGGGTCCGGGAGCGCGGCGGAGACGATGCCTGAGATCAGAGTCACGCCCTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl