Prev. |  KEGG KO K07541 > 

RIKEN DNA Bank Human Resource - PIGX

Gene ID NCBI Gene 54965 |  KEGG hsa:54965
Gene Symbol PIGX
Protein Name phosphatidylinositol glycan anchor biosynthesis class X
Synonyms PIG-X
Ortholog resources KEGG ortholog (KEGG orthology K07541) in the DNA Bank
Links

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence CDS status(2)
Submitted (DDBJ)(1) Refered (NCBI mRNA)
HGY012926 IRAK032F06 pBluescriptR BC022542 NM_017861 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_190322.csv
GNP_full_IRAL_190322.csv


Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

M series

Catalog number Clone name Vector Constructed from(1) Refered mRNA Status
Clone ID Sequence (DDBJ)
HGE089217 M01C023A17 pDONR221 MGC01-A09 BC022542 ENST00000314118  
HGE089265 M01C023C17 pDONR221 MGC01-A09 BC022542 ENST00000314118  
HGE089313 M01C023E17 pDONR221 MGC01-A09 BC022542 ENST00000314118  
HGE089361 M01C023G17 pDONR221 MGC01-A09 BC022542 ENST00000314118  
HGE089409 M01C023I17 pDONR221 MGC01-A09 BC022542 ENST00000314118  
HGE089457 M01C023K17 pDONR221 MGC01-A09 BC022542 ENST00000314118  
HGE089505 M01C023M17 pDONR221 MGC01-A09 BC022542 ENST00000314118  
HGE089553 M01C023O17 pDONR221 MGC01-A09 BC022542 ENST00000314118  

♦ M series clone does not contain stop codon.

GNP_entry_M01C_160109.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.
♦ Please visit a web site of the Life Technologies for datail of the Gateway® vector system and entry clone: http://www.invitrogen.com


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector mRNA RefSeqs/DDBJ accession(1) Status
5'-terminal sequence(2)
HKR341625 RBb54B01 pGCAP1 NM_017861.2  
GGGGAACCGCGGGCGCTAGGCGCGCGCACCCAGCACTCGGTCCCAGCCGATAAATCTGGG

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_160109.csv
NRCDhumcloneList_RB_160109.csv


2020.01.09

Homo_sapiens_gene_info171028.csv - RDB_hum_GIxxxxxxxxx_html_191217.pl