Prev. |  KEGG KO K10904 > 

RIKEN DNA Bank Human Resource - TIPIN

Gene ID NCBI Gene 54962 |  KEGG hsa:54962
Gene Symbol TIPIN
Protein Name TIMELESS interacting protein
Synonyms -
Ortholog resource in our bank

  TIPIN

External database

  KEGG gene

  KEGG Ortholog

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001908 IRAK004M20 pCMV-SPORT6 BC000870 NM_017858 Full/var

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR371252 RBd28C04 pGCAP10 NM_017858.2  
GACGCCGAGGTCCGCGCTGTGTCCCGTGTTTTCTGCGTGAGAGGAAAAGATGCTAGAACC
HKR372060 RBd30C12 pGCAP10 NM_017858.2  
ACGTCGCCCCAGGAGTTCCCGAGTATCGCGAGAAGCGCGCTTAGTCTGCACGCCGAGGTC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl