Prev. | 

RIKEN DNA Bank Human Resource - TXNL4B

Gene ID NCBI Gene 54957 |  KEGG hsa:54957
Gene Symbol TXNL4B
Protein Name thioredoxin like 4B
Synonyms DLP|Dim2
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene

Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX001848 IRAK004K08 pCMV-SPORT6 BC009646 NM_017853 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv

Genome Network Project (GNP) Gateway® Entry Clone

Plasmid request [in Japanese] [in English]

W series

Catalog number Clone name Vector Constructed from(1) CDS comparison Status
Clone ID Sequence (DDBJ) Refered mRNA CDS status
HGE004210 W01A010I18 pENTR-TOPO IRAK004K08 BC009646 NM_017853  
HGE004212 W01A010I20 pENTR-TOPO IRAK004K08 BC009646 NM_017853  
HGE004214 W01A010I22 pENTR-TOPO IRAK004K08 BC009646 NM_017853  

♦ W series clone contains a stop codon.

GNP_entry_W01A_2023Apr24.csv

♦ Full length sequence is not available. ORF information might be updated by now and thus actual insert could differ from the latest version.
♦ GNP Gateway® entry clone was constructed from the open reading frame (ORF) amplified by PCR.
(1) ID and associated information of the cDNA clone used as a template of PCR.

NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR234246 ARiS085K06 pGCAP10 NM_017853.1  
GGTTGAGCGGGGGCCGACCGACGGCCAGGAGTTTCTTTTCTGCGCTTGTGCGTTTTCTGT
HKR394530 RBd86F10 pGCAP10 NM_017853.1  
GGGGCTGTTGAGCGGGGGCCGACCGACGGCCAGGAGTTTCTTTTCTGCGCTTGTGCGTTT

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv

2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl