Prev. | 

RIKEN DNA Bank Human Resource - TRNAU1AP

Gene ID NCBI Gene 54952 |  KEGG hsa:54952
Gene Symbol TRNAU1AP
Protein Name tRNA selenocysteine 1 associated protein 1
Synonyms PRO1902|SECP43|TRSPAP1
Ortholog resource in our bank

External database

  KEGG gene

  NCBI Gene


Genome Network Project (GNP) Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector Sequence submitted (DDBJ)(1) CDS comparison
Refered (NCBI mRNA) CDS status(2)
HGX031964 IRAK079P04 pCMV-SPORT6 BC035855 NM_017846 Full/var
HGX031966 IRAK079P06 pCMV-SPORT6 BC039879 NM_017846 Full/var
HGY082230 IRAL005J14 pOTB7 BC000680 NM_017846 Full

(1) Actual nucleotide sequence of this clone submitted to the DNA Data Bank of Japan (DDBJ)/EMBL/Genbank.
(2) CDS status was determined by comparing the clone sequence with NCBI RefSeq mRNA.
♦ Full, whole CDS.
♦ Full/var, whole CDS though with ins/dels or substitution.
♦ Partial, partial CDS
♦ Partial/var, partial CDS though with ins/dels or substitution.

GNP_full_IRAK_2023Apr24.csv
GNP_full_IRAL_2023Apr24.csv


NRCD Human cDNA Clone

Plasmid request [in Japanese] [in English]

Catalog number Clone name Vector CDS comparison Status
Refered mRNA(1) CDS status
5'-terminal sequence(2)
HKR338147 RBb45G03 pGCAP1 NM_017846.4  
GCCCGCCCGCAGAGCCCCGCCCGCAAAGTCCCACCCCGGTGCGCGGGTATGGCGGCCAGC

♦ Full length sequence is not available. The clone could differ from the NCBI mRNA reference sequence.
♦ These clones have very long transcript since they were constructed by the method "Vector Capping."
(1) Refference sequence either NCBI mRNA or DDBJ DNA identified by the 5' terminal sequence.
(2) 5' terminal sequence of the insert provided from the depositor.

NRCDhumcloneList_AR_2023May03.csv
NRCDhumcloneList_RB_2023May03.csv


2023.05.08

Homo_sapiens_gene_info200108.csv - RDB_hum_GIxxxxxxxxx_html_230504.pl